倒圆角怎么画:DNA modification by sulfur: analysis of the sequence recognition specificity surrounding the modific

DNA modification by sulfur: analysis of the sequence recognition specificity surrounding the modification sitesJingdan Liang, Zhijun Wang, Xinyi He, Jialiang Li, Xiufen Zhou, and Zixin Deng^*Laboratoryof Microbial Metabolism and School of Life Science & Biotechnology,Shanghai Jiaotong University, Shanghai 200030, China*To whom correspondence should be addressed. Phone: +86 21 6293 3404, Fax: +86 21 6293 2418, Email: zxdeng@sjtu.edu.cnThe authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.Received February 15, 2007; Revised March 9, 2007; Accepted March 12, 2007.

Thisis an Open Access article distributed under the terms of the CreativeCommons Attribution Non-Commercial License(http://creativecommons.org/licenses/by-nc/2.0/uk/) which permitsunrestricted non-commercial use, distribution, and reproduction in anymedium, provided the original work is properly cited.

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES AbstractThe Dnd (DNA degradation) phenotype, reflecting a novel DNA modification by sulfur in Streptomyces lividans 1326, was strongly aggravated when one (dndB) of the five genes (dndABCDE)controlling it was mutated. Electrophoretic banding patterns of aplasmid (pHZ209), reflecting DNA degradation, displayed a clear changefrom a preferential modification site in strain 1326 to more randommodifications in the mutant. Fourteen randomly modifiable sites onpHZ209 were localized, and each seemed to be able to be modified onlyonce. Residues in a region (5′-c–cGGCCgccg-3′) including a highlyconserved 4-bp central core (5′-GGCC-3′) in a well-documentedpreferential modification site were assessed for their necessity bysite-directed mutagenesis. While the central core (GGCC) was found tobe stringently required in 1326 and in the mutant, ‘gccg’ flanking itsright could either abolish or reduce the modification frequency only inthe mutant, and two separate nucleotides to the left had no dramaticeffect. The lack of essentiality of DndB for S-modification suggeststhat it might only be required for enhancing or stabilizing theactivity of a protein complex at the required preferential modificationsite, or resolving secondary structures flanking the modifiablesite(s), known to constitute an obstacle for efficient modification.Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES INTRODUCTION

A novel DNA sulfur modification was found in the soil-dwelling, antibiotic-producing bacteria Streptomyces lividans and Streptomyces avermitilis. Three distinctive features were associated with the modification: (1) Tris-dependent DNA degradation occurred during normal or pulse-field gel electrophoresis (the Dnd phenotype); (2) the Dnd phenotype did not seem to be inhibited by treatment with formaldehyde, proteinase K and/or lysozyme; and (3)the Dnd phenotype could be repressed if the electrophoretic buffer wassupplemented with a small amount of reducing agents, especially thosecontaining sulfur, like thiourea, or if Tris was replaced by Hepes inthe electrophoresis buffer (1–6). The Dnd phenotype and its inhibition in the presence of thiourea were not limited to the above-mentioned two Streptomyces strains, but found in a large array of gram-positive and -negative bacteria such as Mycobacterium abscessus (7), Salmonella spp. (1,8–10), E. coli strains (1,9,10), Pseudomonas flurensences, Pseudomonas aeruginosa (11), Clostridium difficile (12,13), Klebsiella pneumoniae, Enterobacter cloacae and Serratia marcescens (10),although in most cases the phenomenon has been interpreted as nucleasecontamination in the DNA samples. Gene clusters rendering Dnd phenotypehad been identified in S. lividans, S. avermitilis, and many of the above-mentioned microorganisms (4, and X. He et al., submitted for publication).

TheDNA sulfur modification is site specific, as well as post-replicativebecause single-stranded plasmid replication intermediates do not seemto contain the modification sites, as evidenced from primer extensionexperiments (5,14).The dsDNA modifications occur at the first guanine residues within a6-bp palindromic core sequence of cGgccg, as elegently identified byDyson et al. (14,15).Three independent pairs of a 13-bp direct repeat flanking both sides ofthe modified site were also recognized to be important for themodification process. Deletion of either the leftmost or the rightmostrepeat abolished the modification, whose site lies within the centralrepeat sequence, while deletion of the left-hand repeat changed themodification to other sites on plasmid pIJ101 (3,14,15).

Recently, we reported that the dnd locus (Figure 1A) of S. lividans 1326 is directly involved in the DNA modification process that incorporates sulfur into specific sites of DNA (4),although the precise chemical nature of the modification remainsobscure. Experiments including the use of gene disruption and gainand/or loss of function techniques showed that the five genes in the dndlocus are all essential for the DNA sulfur modification. Of these,DndA, DndC, DndD and DndE showed remarkable similarities to cysteinedesulfurase, PAPS reductase, chromosome segregation protein andphosphoribosylaminoimidazole carboxylase, respectively. While DndBshowed 25% identity and 38% similarity to ABC transporter ATPase from Sphingomonas sp. SKA58 (ZP_01303985), and 26% similarity to a DNA gyrase (GyrB) from Mycoplasma putrefaciensit is also noticeable that the predicted DndB is likely to be a basicprotein (pI: 8.79) under physiological conditions and would conceivablybind nucleic acids. Indeed, this feature was implied by the fact thatthe Dnd phenotype was significantly aggravated in a dndB⁻ mutant, reflecting a relaxed preference for modification sites on DNA. Here, we describe an altered Dnd phenotype in a dndB⁻mutant, and its subsequent use for the convenient and detailedcharacterization of the consensus sequence on a pIJ101-derived plasmid,pHZ209, containing a well-characterized preferential modification site.This resulted in a clear demonstration that a consensus sequence with a4-bp central core is highly conserved and required for modification,but the requirement of its flanking sequences differs remarkably inDndB-deficient strain, HXY2. DndB was implicated as an importantmediator for the efficiency of DNA modification.

Figure 1. (A) Organization of the dnd gene cluster and in-frame deletion of dndB. (B) Enhanced Dnd phenotype displayed by dndB⁻ mutant HXY2 as compared with that of wild-type 1326. Lack of Dnd phenotype displayed by dndA⁻ mutant HXY1 and dnd-deletion (more ...) Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES MATERIALS AND METHODS

 

Bacterial strains and plasmidsStreptomyces and E. coli strains used in this study are listed in Table 1. Table 1. Strains and plasmids used in this study

 

General growth conditions and genetic manipulations for Streptomyces and E. coliStreptomyces lividans 1326 and its derivatives were grown at 30°C in TSBY liquid medium containing 34% sucrose and SFM agar medium as described in (16).For the plasmid-containing strains, apramycin or thiostrepton wereadded when needed at a concentration of 30 and 10 μg/ml, respectively.Qiagen Max Plasmid Kits were used to extract plasmid DNA from Streptomyces. Protoplast transformation was described in detail in (16).

pHZ209,and the mutated pHZ209 derivative plasmids were introduced bytransformation into 1326, HXY2, HXY6, LJD1, LJD2 and LJD3 by protoplasttransformation as described in (16). Isolated DNA (16) was generally stored in autoclaved TE buffer before use.

 

Cloning of cleaved DNA fragments of pHZ209 after treatment with activated Tris bufferEscherichia coli cultivation and plasmid manipulation were according to (17). DH10B was used as general E. coli host for plasmid transformation.

DNA fragments of 2.4 and 3.0kbrecovered from agarose gels were blunt-ended with Taq DNA polymerasewith an extension temperature at 72°C and ligated into pMD18-T. Theresultant plasmids carrying the inserts were sequenced by Bioasia Co.,Ltd, Shanghai.

The efficiency of cloning the Taq DNA polymeraseblunt-ended DNA fragments into pMD18-T using the above method was low.Thus, cloning of the cleaved DNA fragments after treatment withactivated Tris-buffer was modified as follows: SmaI-digested pJTU2018 (Table 1)was dephosphorylated with CIP before a 2926-bp fragment was purifiedfrom an agarose gel and used as a cloning vector. EcoRV-linearizedpHZ209 from S. lividans 1326 or HXY2 was cleaved by activatedTris-buffer prepared as described below. The cleaved plasmids wereprecipitated with ethanol and re-suspended in water before treatmentwith T4 polynucleotide kinase (MBI) according to the company‘sprotocol. The T4 polynucleotide kinase was inactivated by treatment at70°C for 10min. Forty units of ExoIII/µg DNA was added to trim the 3′ end for 2min at room temperature before its deactivation at 70°C for 10min. After re-precipitation with ethanol, the DNA fragments were blunt-ended with KOD DNA pol (Takara) at 68°C for 30min.DNA fragments extracted with phenol/chloroform and precipitated withethanol were then ligated with the above-mentioned blunt-ended anddephosphorylated vector DNA from pJTU2018. The desired plasmids weresequenced by Shanghai DNA Biotechnologies Co., Ltd.

 

Cleavage of pHZ209 and its mutant derivatives by activated Tris-bufferpHZ209 and its mutant derivatives were extracted from the wild-type S. lividans 1326, or its mutants HXY2 and HXY6, and linearized with EcoRV. Activated Tris-buffer (electrophoresised TAE buffer) for in vitro DNA cleavage at the S-modification sites was prepared as described in (3) with slight modifications: the 1× TAE buffer was kept running at a constant 80V at room temperature, with a total running time of 8h in an electrophoresis tank.

Five hundred and ninety microliters of buffer was sampled near the anode (3) and added to a 10µl sample containing 500nglinearized pHZ209, before 4–15-h incubation at 37°C for adequatecleavage. The resulting samples were precipitated, dried, re-suspendedin 20µlTE buffer and loaded onto a 1% agarose gel for electrophoresis beforedesired fragments were recovered. The relative DNA band intensitieswere analyzed using Quantity One software (Bio-Rad). Sequencessurrounding the cleaved ends were aligned from 5′ to 3′ ends with twofixed cleavage sites.

 

In-frame deletion of the dndB gene in S. lividans 66pHZ868, a pHZ132 (18,19) derivative carrying the complete dnd gene cluster (Table 1), was digested with XhoI to generate a 1971-bp DNA fragment carrying part of dndBencoding the C-terminal amino acids, which was recovered from anagarose gel and ligated into the SalI site of pOJ260, giving rise topJTU155. Oligonucleotide primers dndB-L (5′-CAGAATTCGAAACTTCCCATCACTC-3′, EcoRI site underlined) and dndB-R (5′-CATGGATCCCTTGTTCAAGATCCG-3′,BamHI site underlined) were used to amplify a 1.85-kb DNA region withan internal 1674-bp EcoRI–BamHI fragment carrying part of the dndBgene encoding the N-terminal amino acids, using pHZ868 as template. Theresultant DNA fragment was digested with EcoRI and BamHI beforeligation into the corresponding sites of pJTU155 digested with the sameenzymes, generating pJTU156. pJTU156 was further digested with SpeI toaccept another 1.23-kb XbaI–SpeI oriT-carrying fragment frompOJ260 for the final construction of pJTU164. The desired mutant, HXY2,was isolated after pJTU164 was transferred by conjugation into S. lividans 1326, and selected for deletion of the internal 867-bp dndB region encoding 289 amino acids of the DndB protein (Figure 1A), which was confirmed by PCR and Southern blotting analysis from six mutant candidates.

 

Constructs carrying a single dndB gene and a complete dnd gene cluster for genetic complementation of a dndB mutantThe dndB gene was amplified from total DNA of 1326 using dndB-L (TTGCCGAATTCCGCGGTCATCCAGTGCAG, EcoRI site underlined) and dndB-R (CGCGGATCCCCTCCGTCAGCTCCTCGAC,BamHI site underlined) as PCR primers. The 1376-bp fragment obtainedwas digested with EcoRI and BamHI before ligation into pSET152 (Table 1) digested with the same enzymes. The resultant plasmid, pJTU2020, and pSET152 (Table 1) were transferred from E. coli ET12567 carrying pUZ8002 into HXY2, to generate LJD1 and LJD3 (Table 1). Concurrently, conjugation of pHZ1904 from E. coli ET12567 carrying pUZ8002 into HXY2 generated LJD2 (Table 1).

 

Site-directed mutagenesis of the preferentially recognized sequence on pHZ209Site-directedmutagenesis of a sequence (nucleotides 2374–2385 of pHZ209) includingthe 4-bp central core and some of its flanking nucleotides from bothsides (5′-cGGCCgccg-3′) was independently achieved by cloning fusionPCR products with an identical DNA fragment of the same size (1187bp),but carrying mutations at various positions along 5′-cGGCCgccg-3′, allto A, based on a two-step PCR technique as described in (20).Briefly, PCR amplification using a fixed primer (UP1) designed upstreamof an EcoRI site leftward to the nucleotides to be mutated (i.e.nucleotides upstream of 2374–2385) and variable primers (DP2 series,depending on the site to be mutated) would generate a Step Ia product(725bp).Meanwhile, PCR amplification using variable primers (UP3 series,depending on the site to be mutated) and a fixed primer (DP4) designeddownstream of an XhoI site rightward to the nucleotides to be mutated(i.e. nucleotides downstream of 2374–2385) would generate a Step Ibproduct (502bp).A mixture of the Step Ia and Ib products (with a 40-bp overlap betweenthe 3′-end of Ia and the 5′-end of Ib, to provide mutual priming) wasused as templates in a subsequent PCR amplification using two fixedprimers (UP1 and DP4) to yield the Step II product (1187bp). On digestion with EcoRI and XhoI, fragments of identical size (949bp)but variable mutations along 5′-cGGCCgccg-3′ were ligated into thecorresponding sites of pBluescript II SK(+), to obtain transientplasmids in E. coli DH10B. Their EcoRI–XhoI fragments wererecovered from agarose gels and cloned into the corresponding sites ofpHZ209 after digestion with the same enzymes (EcoRI and XhoI), so thatthe fragment of the same size was conveniently replaced. All thereplaced fragments in pHZ209 derivatives were sequenced to confirm thedesired mutation at specific nucleotide positions before protoplasttransformation of S. lividans 1326 and its mutants HXY2 andHXY6 to test the effect of each mutation on modification specificity.All the primers used and plasmids obtained are listed in Table 2. The three-step PCR conditions were as follows: 30 rounds of denaturation at 94°C for 5min, 60°C annealing for 30s followed by extension at 68°C for 20 or 40s using KOD-Plus DNA polymerase. Table 2. Primers and resultant plasmids for site-directed mutagenesis Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES RESULTS

 

Differences in the Dnd phenotype between wild-type S. lividans 1326 and its dndB mutant HXY2An analysis of the Dnd phenotype displayed by HXY2 (with an in-frame deletion in dndB)in comparison with its progenitor wild-type strain 1326 indicated thatthe mutation does not prevent the genomic DNA of the mutant strain HXY2from degradation during electrophoresis (Figure 1B). In sharp contrast, the Dnd phenotype was lost in the mutants ZX1 [with deletion of ∼93-kb DNA including the complete dnd locus (4,21), data not shown] and HXY6 (with a targeted deletion of ∼8kb covering the complete dnd locus) (Figure 1B), and those mutant strains with gene disruptions inside dndA (ZX64 and HXY1) or dndD (LA2), whose DNAs were all stable (4) (data not shown).

Thus, the mutation in dndB seemed to be unique among all of the mutants tested.

Abrief comparison of the Dnd phenotype between DNA of HXY2 and 1326,however, revealed that the degradation ‘smear’ from the genomic DNA ofHXY2 migrated much faster than that from strain 1326, suggesting thatsmaller DNA fragments were generated from degradation of HXY2 DNA thanfrom 1326; in other words, the dndB mutation appeared to aggravate the Dnd phenotype (Figure 1B).

To unambiguously explore how the dndBmutation could affect DNA degradation or modification, we used apIJ101-derivative plasmid, pHZ209, which contains at least onepreferential modification site, with a characterized central coresequence flanked by three direct repeats (14)to test the possible alteration in modification pattern. After passageof pHZ209 into HXY2, 1326 or HXY6 (with deletion of the complete dnd locus), DNAs were extracted and treated with activated Tris buffer [general DNA electrophoresis buffer, (22)] before being heavily loaded on an agarose gel for detection of the Dnd phenotype (Figure 1C).

Distinctive bands could be observed from pHZ209 DNA isolated from the in-frame deletion mutant HXY2 (pHZ209/HXY2 in Figure 1C), corresponding to the bands of the same sizes observed from the wild-type 1326 (pHZ209/1326 in Figure 1C),while pHZ209 DNA originating from HXY6 remained stable as a linearizedbut non-degraded 5.4-kb band on the gel (pHZ209/HXY6 in Figure 1C), indicating that it was not cleaved by activated Tris buffer.

Closerexamination of the distinctive banding pattern generated afterdegradation using plasmid DNA revealed that the DNA modificationpreferences in the wild-type 1326 and the dndB mutant HXY2were different. The great majority of the pHZ209 DNA in both lanes,pHZ209/1326 and pHZ209/HXY2, remained stable as a 5413-bp non-degradedand linearized pHZ209, as originally loaded in lane pHZ209/HXY6,suggesting that not all of the pHZ209 DNA molecules were modified, inagreement with the early report by Zhou et al. (4,5). Two bands (running at ∼3.0 and 2.4kb, Figure 1C)were much stronger than any others degraded from EcoRV-linearizedpHZ209 DNA isolated from 1326. They were ∼ 43% reduced (as calculatedfrom band scanning) with concurrent increase of the intensity of allthe other degradation products when pHZ209 DNA came from HXY2. Thedifference in the Dnd phenotype between wild-type 1326 and its dndBmutant HXY2 was confirmed by complementation by introducing pHZ209 intoa HXY2 derivative, using a plasmid carrying either the dndB gene alone (pJTU2020) or the complete dnd gene cluster (pHZ1904) for integration into the attBsite of the chromosome to generate LJD1 and LJD2 respectively. A strain(LJD3) receiving a control vector pSET152 without insert had no sucheffect (Figure 2A).

Figure 2. Restoration of modification preference towards EcoRV-linearized pHZ209 (A) and partial restoration of modification preference towards EcoRV-linearized pJTU2003 (in which the nucleotide ‘C’ at position 2384 of pHZ209 was mutated to ‘A’ (more ...)

 

Each pHZ209 molecule seemed to be modified only once at mostOne (∼3.0kb) of the two most intense bands (∼3.0 and 2.4kb) originating from degraded pHZ209 in 1326 (Figure 1C)could easily be recovered from an agarose gel, cloned into pGEM-T andsequenced. It was found to be generated by cleavage at a preferentialmodification site (14), generating an uninterrupted linear band corresponding to 3034bp (Figure 1C)extending from the preferential modification site to the rightmostEcoRV site [ends cleaved by the activated Tris buffer could easily bedistinguished from the other end of the sequenced fragment as it waslabeled by an EcoRV site (Figure 3)before electrophoresis on agarose gel in activated Tris buffer]. Thissuggested that the plasmid molecule is not further modified in otherpositions once the preferential site is modified. If this site were theonly one that could be modified in vivo, no other degradation bands should be observed. Figure 3. (A) Alignment of the region traversing the modified sites (labeled as asterisks) sequenced by using pBluescript II SK(+) (left) or pMD18-T (right) as vectors for the identification of the central four nucleotides (GGCC) as the highly consensus region, (more ...)

This is obviously not the case as we saw many additional bands resulting from the cleavage of pHZ209, in either 1326 or HXY2 (Figure 1C)at other positions. This prompted us to attempt sequencing of as manyas possible of the additional fragments with modified terminioriginating from degraded pHZ209 in HXY2.

A total of 141 cloneswere obtained after EcoRV-linearized pHZ209 was treated with activatedTris-buffer to cleave the modified site before insertion intoSmaI-digested pBluescript SK(+), and subjected to multiple restrictionenzyme analysis (data not shown). Thirty-three clones equal in size tothat of linearized pHZ209 (ca 5.4kb)(three of which were confirmed to be linearized pHZ209 by sequencingfrom both termini), and 15 clones with inserts larger than 5.4kb(and so carrying multiple fragments), were disregarded. Forty-eight ofthe 93 remaining clones, which were obviously smaller than linearizedpHZ209 (5.4kb),were selected for sequencing from both termini. Apart from one clonethat seemed to derive from degradation of contaminating chromosome DNA,41 clones each contained a contiguous piece of pHZ209 DNA, clearlyderived from degradation at a single site, and the other six clonescontained rearranged DNA fragments resulting from ligation of at leasttwo degraded pHZ209 fragments.

The terminal sequences resultingfrom ligation of a single DNA fragment among 24 clones could be mappedto 16 positions relative to the unique reference site (EcoRV) onpHZ209. A preliminary assembly of the end positions of 14 sequencereads indeed first revealed an obvious sequence conservation (Figure 3) conforming to the site identified by Dyson et al. (14,15), although the two modified nucleotides on opposite strands (Figure 3)seemed to be adjacent rather than separated by two bases within theconsensus region as originally identified by experiments involving in vitroTris-activation and PCR (see Discussion). However, 17 independentsequence reads did not conform to the consensus sequence (not shown)but matched totally random nucleotide positions on pHZ209, in sharpcontrast to those sequence reads leading to the assembly of theconsensus sequence in Figure 3A, some of which had been sequenced more than once using random and independent clones from the same cloning experiment.

Inan attempt to discover whether all the sequence reads, or only thoseconforming to the consensus sequence, represented genuine modifiablesites, we repeated the above cloning experiment using EcoRV-linearizedpHZ209 isolated from HXY6 (a strain with complete deletion of the dndgene cluster, hence without modified DNA). Indeed, 24 multiple cloneswere obtained, but none of the sequence reads from them corresponded toconsensus sequences, and none of them matched the sequences from therandom and independent clones generated in the earlier experiment,suggesting that they were ‘noise’ sequences generated by non-specificand physical breakage of DNA fragments during the cloning processinvolving in vitro treatment with activated Tris-buffer and exonuclease III.

In order to confirm that mapped modifiable sites on pHZ209 (Figure 3B)originating from the above assembled consensus sequence weremeaningful, thus ruling out non-specific noise, we sequenced DNAfragments from some additional isolatable specific bands from degradedpHZ209 in HXY2 after cloning into pGEM-T in the same way as we had donefor one of the two most intense bands (3034bp) of pHZ209 from 1326 (Figure 1B). Four bands were chosen (4R, 5R, 6R and 9R, Figure 3A), whose sizes added up to 5.4kb,equivalent to the total size of pHZ209. (Sequencing of other fragmentpairs was unsuccessful, mainly because different DNA fragments of thesame size were recovered for cloning, which resulted inco-transformation influencing the sequencing reads.) Consistently, thedistribution of these sequence reads, which were sure to have resultedfrom the Dnd phenotype, could be easily localized at positions 4, 5, 6and 9, respectively in Figure 3B,conforming to the same sites for the generation of the consensussequence as from the shotgun cloning into pBluescript M13(+) describedabove (Figure 3A).

Thecommon consensus sequence generated from either a shotgun cloning of amixture of fragments [into pBluescript SK(+)] or from the targetedcloning of specific fragments (into pGEM-T) clearly suggested that eachdegraded DNA fragment originated from specific cleavage of the plasmid,which had been modified at different modifiable positions, and thateach pHZ209 molecule is modified not more than once, even thoughmultiple sites are available for modification. To further prove this,we analyzed the specific banding patterns of the two specificallydegraded fragments from pJTU2031 linearized with three restrictionenzymes on which the recognition sites are all unique (Figure 4). [pJTU2031 is a pHZ209 derivative plasmid with ‘C’ mutated to ‘A’ at nucleotide 2374 (Figure 5),resulting in a reduced intensity of the two specific bands comparedwith those caused by preferential modification in pHZ209]. Modificationat position 10 (L/R), for example, would generate DNA fragments of 4182and 1231bpif pJTU2031 (or pHZ209) was linearized with EcoRV. The banding profilewas assumed to change into one with 3027 and 2386, 3976 and 1437, 4687and 726bp bands if pJTU2031 were linearized with EcoRI, XhoI or NdeI, respectively (Figure 4),as expected (the intensity of the shifted bands varied becauseoccasionally some heterologous fragments of the same sizes migratedtogether, as detected before in Figure 1). In fact, nearly all of the degraded DNA fragments seen in Figure 1could be attributed to cleavage at one specific site of the many on theEcoRV-linearized pJTU2031 (or pHZ209), thus establishing a map withS-modifiable sites (Figure 3).In other words, the sizes of any pair of fragments generated bycleavage of linearized pJTU2031 (or pHZ209) at any modifiable site in Figure 3 correlated well with the corresponding bands in Figure 1 (and/or Figure 4),confirming the conclusion that each pJTU2031 (or pHZ209) molecule couldbe modified either at none or, at most, only one of the multiplemodifiable sites, which is also consistent with the routine observationthat the cleavage of un-linearized pHZ209 will only generate aconcentrated full-size linear fragment together with some un-cleavablecircular pHZ209 (not shown), as detected on agarose gels.

Figure 4. Banding patterns of pHZ2031 respectively linearized using four different but unique restriction enzymes (EcoRV, EcoRI, XhoI and NdeI) before treatment with activated Tris-buffer. Two fragments adding up to the size of linearized pHZ2031 (5.4kb) (more ...) Figure 5. Site-directed mutagenesis of a region traversing the consensus sequence by a two-step PCR technique involving use of two variable oligonucleotide primers (DP2 and UP3) for introducing mutations at variable positions (indicated as a star in the primer (more ...)

 

Analysis of the consensus sequence by site-directed mutagenesisA site-directed mutagenesis of the identified consensus sequence surrounding the cleaved ends (Figure 3), which agreed well with the identification of the conserved region using DNA from chromosome and plasmid DNA (14,15),was performed to evaluate the significance of each of the highlyconserved nucleotide residues (GGCC), and its flanking but probablymore flexible nucleotide residues in determining the site-specificityof DNA modification. We again chose to mutate the site surrounding thepreferential recognition sequence 5′-cGGCCgccg-3′ (Figure 3), whose specificity changes could easily be monitored by the intensity changes of the bands of 3.0 and 2.4kb after DNA cleavage (Figure 5). Each of the 9bpin the putative consensus sequence (5′-cGGCCgccg-3′) was independentlychanged to an ‘A’ by three steps of PCR-based sited-directedmutagenesis (see Materials and methods section) before each of themutated pHZ209 derivatives was independently introduced into 1326 andHXY2, respectively. pHZ209 DNA was then isolated from each transformantin order to detect possible small changes in the Dnd phenotypereflected by variations in DNA banding patterns.

Both the 3.0- and2.4-kb bands remained unchanged no matter whether pHZ209 originatedfrom 1326 or HXY2 when the first residue ‘c’ of the 5′-cGGCCgccg-3′ wasmutated to ‘A’ (Figure 5A, lanes 3 and 4) as compared with their respective controls (Figure 5A,lanes 1 and 2) without mutation. In sharp contrast, each independentchange from any one of the following four residues from ‘GGCC’ to ‘A’resulted in complete disappearance of the two DNA bands, no matterwhether pHZ209 DNA came from 1326 (Figure 5A, lanes 5, 7, 9 and 11) or HXY2 (Figure 5A,lanes 6, 8, 10 and 12). Thus, each of the four residues GGCC wasdeduced to be equally essential for modification specificity both in1326 and in HXY2.

When each of the last four residues ‘gccg’ wasindependently mutated to ‘A’, the relative intensity of the twocorresponding DNA bands did not seem to change if the mutated plasmidscame from 1326 (lanes 3, 5, 7 and 9 in Figure 5B).In contrast, when the plasmid DNA originated from HXY2, the two bandsalmost disappeared when the first ‘g’ of the last four residues ‘gccg’was mutated to ‘A’ (Figure 5B, lane 4), but was ∼50% reduced for the corresponding change in the third ‘c’ (Figure 5B, lane 8), while changes in the second ‘c’ and the fourth ‘g’ had little effect (lane 6 and 10 in Figure 5B),as judged by their scanned band intensities. Thus, while gccg isconcluded as non-essential for modification specificity in 1326, thefirst (g) and the third (c) of the four nucleotides (gccg) is eitheressential or important in HXY2. As a control, a pHZ209 derivative(pJTU2003) with a ‘c’ at the third position of the ‘gccg’ mutated to‘A’ in HXY2 (Figure 2B) could be fully complemented when pHZ1904 carrying the complete dnd gene cluster, was integrated into the chromosome of the host strain HXY2, forming LJD2 (Figure 2B), or partially complemented by pJTU2020 carrying the dndB gene only, forming LJD1 (Figure 2B).

A similar mutation three nucleotides left of the central core (site 2374 in Figure 5B, lane 11) also caused a ∼40% reduction of the relative modification frequency in HXY2.

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES DISCUSSION

Theconsensus sequence (5′-cGGCCgccg-3′) identified in this work agreeswell with that deduced from analysis of preferential modification sites(14,15),although the modified site positions varied by one base pair inwardfrom each side, still at G on both strands. A combination of earlierreports (14,15)and our current work indicates that the base-pairing between C andmodified G, if it still occurs, is probably not as strong as normal G–Cpairing, and therefore, the primer extension reactions (14,15)used earlier to localize preferential modification sites could have runoff one base before meeting the modified/cleaved site(s), in all cases.

It is obviously difficult to predict exactly how the five products of the dndgene cluster interact with each other, and with the nucleotides of thehighly conserved central core or the flanking regions. The absoluterequirement of the central core (GGCC), in which modification siteswere located at the two central bases on complementary strands,indicates unambiguously that the modifying activity is concentrated onthese four nucleotide residues (GGCC) both for preferential and randommodification in wild-type 1326 and in the dndB⁻mutant HXY2. Conceivably, these four nucleotides must be in close anddirect contact with one of the major modifying enzymes. Thepreferential recognition specificity, totally unaffected in 1326 butvariably abolished or reduced in HXY2, after mutation of the fournucleotides flanking the right, and two separated nucleotides flankingthe left of the central core (GGCC), strikingly implicates thenecessity of DndB in determining the recognition specificity. Thisagreed well with the detection of the significant amino acid sequencesimilarity of DndB to a DNA gyrase, which suggests that the DndBprotein could in someway affect DNA topology, and thus the efficiencyand/or specificity of S-modification on certain sites flanked by thesequences with a potential to form secondary structures. This couldalso explain why the DndB protein is not required at ‘simple’recognition sites without flanking sequence complexity. We assume thatthe change from preferential modification sites, as detected inwild-type 1326, to a relatively random distribution of modificationsites, as detected in its dndB mutant HXY2, is mediated by the DndB protein encoded by dndB.It is likely that random modification does not need DndB but a closeassociation of DndB with the modifying enzymes could stabilize thecontact between GGCC and the modifying complex.

It is not clearwhy a 5.4-kb circular plasmid molecule could only be modified once,although multiple modification sites are available. The presence ofnumerous modifiable sites on the chromosome suggests that modificationfrequency does not depend on the number of molecules, large or small,but more likely, by the length of the DNA flanking both sides of themodified site occupied by modifying enzymes. We do not know whether itis the binding of the modifying enzyme complex to a specificGGCC-containing site, or the result of modification, which preventsfurther binding of the modifying enzyme complex to a neighboringGGCC-containing site on either chromosome or plasmid, but it is hard tothink that the result of modification could have contributed to thisphenomenon. The fact that the Dnd phenotype could only be observed whena plasmid carrying the dnd gene cluster was present either inthe integrated form or on a low copy number (<10) plasmid, but notat high copy number (Li,A.. unpublished data) implied that theexpression of the dnd gene cluster in 1326 could be tightlycontrolled, and thus the dosage of the modifying enzyme complex couldbe limited in the cell. We propose that a protein complex formed at onespecific site which involved nicking, winding and unwinding of thesupercoiled double helix could exclude nearby site(s), andadditionally, the number of sets of the Dnd protein complex isrestricted to a cell-tolerated number by an unknown mechanism. To testthe former hypothesis, it would be interesting to define theapproximate length of the sequences flanking the consensus GGCC, withinwhich modifiable sites were insensitive to modification, by analyzingplasmids of variable size. This work is now under consideration.

Theproposed biochemical pathway leading to DNA modification by S involvesfive putative proteins encoded by a well-characterized dndgene cluster. Of these, DndA was characterized as a PLP-containinghomodimer that specifically catalyzes formation of L-alanine andelemental S using L-cysteine as substrate, DndC as an ATPpyrophosphatase catalyzing hydrolysis of ATP to pyrophosphate (PPi),and the function of DndC was found to be mediation of the formation ofan [4Fe-4S] iron–sulfur cluster protein, whose reconstitution wasactivated by DndA (25). Instead, the exact biochemical functions ofDndD and DndE, have not been demonstrated. While DndD, abioinformatically predicted SMC-like ATPase with a distinguishablemyosin-tail consisting of a coiled-coil region and a flexible hinge,could function as an ATP-modulated DNA cross-linker and energygenerator by ATP hydrolysis, DndE was expected to involve indetermining the sulfur-existing status. From the present work, it seemsreasonable to assume that DndC, forming a [4Fe–4S] iron–sulfur clusterprotein, might provide a platform for the orchestrated assembly of theDnd protein complex, although some member(s) could be associated or notat specific stages of their required activities. The merit of thepresent work is thus, in essence, to have provided information foradditional experiments aimed at demonstrating the interaction(s)between different proteins or between variable combinations ofprotein(s) and specific target DNA, including those mediating secondarystructure formation and/or binding tightly or loosely under differentcondition(s) using, e.g. immuno-precipitations and gel shift mobilityassays. This work is now in active progress.

 ACKNOWLEDGEMENTS

 

Weare very grateful to Prof. Sir David Hopwood, FRS for his continuoussupport and encouragement throughout this study for many years, andcritical and patient editing of the manuscript. The authors wish tothank the Ministry of Science and Technology (973 (2003CB114205) and863 programs), the National Science Foundation of China, the Ministryof Education of China, and the Shanghai Municipal Council of Scienceand Technology for research supports. Funding to pay the Open Accesspublication charge was provided by grant 2003CB114205 from the Ministryof Science & Technology of China.

Conflict of interest statement. None declared.

Top Abstract INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES REFERENCES1.KoortJ.M., Lukinmaa S., Rantala M., Unkila E., Siitonen A. Technicalimprovement to prevent DNA degradation of enteric pathogens inpulsed-field gel electrophoresis. J. Clin. Microbiol. 2002;40:3497–3498. [PubMed]2.EvansM., Kaczmarek F.S., Stutzman-Engwall K., Dyson P. Characterization of aStreptomyces-lividans-type site-specific DNA modification system in theavermectin-producer Streptomyces avermitilis permits investigation of two novel giant linear plasmids, pSA1 and pSA2. Microbiology. 1994;140(Pt. 6):1367–1371. [PubMed]3.Ray T., Weaden J., Dyson P. Tris-dependent site-specific cleavage of Streptomyces lividans DNA. FEMS Microbiol. Lett. 1992;75:247–252. [PubMed]4.Zhou X.F., He X.Y., Liang J.D., Li A.Y., Xu T.G., Kieser T., Helmann J.D., Deng Z.X. A novel DNA modification by sulphur. Mol. Microbiol. 2005;57:1428–1438. [PubMed]5.ZhouX.F., Deng Z.X., Firmin J.L., Hopwood D.A., Kieser T. Site-specificdegradation of Streptomyces lividans DNA during electrophoresis inbuffers contaminated with ferrous iron. Nucleic Acids Res. 1988;16:4341–4352. [PubMed]6.Evans M., Dyson P. Pulsed-field gel-electrophoresis of Streptomyces lividans DNA. Trends Genet. 1993;9:72. [PubMed]7.ZhangY., Yakrus M.A., Graviss E.A., Williams-Bouyer N., Turenne C., KabaniA., Wallace R.J. Jr. Pulsed-field gel electrophoresis study of Mycobacterium abscessus isolates previously affected by DNA degradation. J. Clin. Microbiol. 2004;42:5582–5587. [PubMed]8.MuraseT., Nagato M., Shirota K., Katoh H., Otsuki K. Pulsed-field gelelectrophoresis-based subtyping of DNA degradation-sensitive Salmonella enterica subsp. enterica serovar Livingstone and serovar Cerro isolates obtained from a chicken layer farm. Vet. Microbiol. 2004;99:139–143. [PubMed]9.Liesegang A., Tschape H. Modified pulsed-field gel electrophoresis method for DNA degradation-sensitive Salmonella enterica and Escherichia coli strains. Int. J. Med. Microbiol. 2002;291:645–648. [PubMed]10.SilbertS., Boyken L., Hollis R.J., Pfaller M.A. Improving typeability ofmultiple bacterial species using pulsed-field gel electrophoresis andthiourea. Diagn. Microbiol. Infect. Dis. 2003;47:619–621. [PubMed]11.Romling U., Tummler B. Achieving 100% typeability of Pseudomonas aeruginosa by pulsed-field gel electrophoresis. J. Clin. Microbiol. 2000;38:464–465. [PubMed]12.Klaassen C.H., van Haren H.A., Horrevorts A.M. Molecular fingerprinting of Clostridium difficile isolates: pulsed-field gel electrophoresis versus amplified fragment length polymorphism. J. Clin. Microbiol. 2002;40:101–104. [PubMed]13.Corkill J.E., Graham R., Hart C.A., Stubbs S. Pulsed-field gel electrophoresis of degradation-sensitive DNAs from Clostridium difficile PCR ribotype 1 strains. J. Clin. Microbiol. 2000;38:2791–2792. [PubMed]14.Dyson P., Evans M. Novel post-replicative DNA modification in Streptomyces: analysis of the preferred modification site of plasmid pIJ101. Nucleic Acids Res. 1998;26:1248–1253. [PubMed]15.Boybek A., Ray T.D., Evans M.C., Dyson P.J. Novel site-specific DNA modification in Streptomyces: analysis of preferred intragenic modification sites present in a 5.7kb amplified DNA sequence. Nucleic Acids Res. 1998;26:3364–3371. [PubMed]16.Kieser, T.;Bibb, M.J.;Buttner, M.J.;Chater, K.F.; Hopwood, D.A. Practical Streptomyces Genetics. Norwich: John Innes Foundation; 2000. 17.Sambrook, J.; Russel, D.W. Molecular Cloning: A Laboratory Manual. 3rd. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 2001. 18.Bao K., Hu Z.H., Zhou X.F., Zhou Q., Deng Z.X. A bifunctional cosmid vector for the mobilized conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Prog. Nat. Sci. 1997;7:568–572.19.Deng Z.X., Bai L.Q. Antibiotic biosynthetic pathways and pathway engineering – a growing research field in China. Nat. Prod. Rep. 2006;23:811–827. [PubMed]20.KuwayamaH., Obara S., Morio T., Katoh M., Urushihara H., Tanaka Y. PCR-mediatedgeneration of a gene disruption construct without the use of DNA ligaseand plasmid vectors. Nucleic Acids Res. 2002;30:E2. [PubMed]21.Zhou X.F., He X.Y., Li A.Y., Lei F., Kieser T., Deng Z.X. Streptomyces coelicolor A3(2) lacks a genomic island present in the chromosome of Streptomyces lividans 66. Appl. Environ. Microbiol. 2004;70:7110–7118. [PubMed]22.Ray T., Mills A., Dyson P. Tris-dependent oxidative DNA strand scission during electrophoresis. Electrophoresis. 1995;16:888–894. [PubMed]23.PagetM.S., Chamberlin L., Atrih A., Foster S.J., Buttner M.J. Evidence thatthe extracytoplasmic function sigma factor sigmaE is required fornormal cell wall structure in Streptomyces coelicolor A3(2). J. Bacteriol. 1999;181:204–211. [PubMed]24.BiermanM., Logan R., O’Brien K., Seno E.T., Rao R.N., Schoner B.E. Plasmidcloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 1992; 116:43–49. [PubMed]25.You, DL.;Wang, LR.;Yao, F.;Zhou, XF.; Deng, Z. Biochemistry.A novel DNA modification by sulfur: DndA is a NifS-like cysteinedesulfurase capable of assembling DndC as an iron-sulfur clusterprotein in Streptomyces lividans. DOI: 10.1021/bi602615k.

---

Articles from Nucleic Acids Research are provided here courtesy of
Oxford University PressWrite to PMC | PMC Home | PubMedNCBI | U.S. National Library of MedicineNIH | Department of Health and Human ServicesPrivacy Policy | Disclaimer | Freedom of Information Act